Cloning and purification of bacteriophage K11 RNA polymerase.
نویسندگان
چکیده
Bacteriophage T7 is the prototype of a group of bacterial viruses that each encode a single subunit DNA-dependent RNA polymerase (RNAP). Other members of this class include the coliphages T3 and BA14, the Salmonella phage SP6, the Pseudomonas phage gh1 and the Klebsiella phage K11 (9,16). The phage RNA polymerases have proven to be useful in a variety of applications, including large-scale RNA synthesis, nucleic acid amplification and as the basis for efficient expression systems in both prokaryotic and eukaryotic cells (5,7,8,15,23,24, 26). To facilitate these applications, the T7, T3 and SP6 RNA polymerases have been cloned (2,11,12,17,24) and more recently have been expressed as histidine-tagged fusion proteins, which greatly simplifies their purification (1,6,10). In this work, we describe the expression and purification of a histidinetagged form of the RNA polymerase encoded by bacteriophage K11. The availability of K11 RNAP furnishes opportunities for additional expression and transcription systems and also provides a useful molecular reagent for comparative analysis of this class of enzymes. Bacteriophage K11 and the host bacterial strain Klebsiella pneumoniae were obtained from the laboratory of Rudolph Hausmann (Freiburg, Germany) via Ian Molineux (University of Texas, Austin, TX, USA). The phages were propagated and harvested by differential centrifugation as previously described for bacteriophage T7 (22), and DNA was isolated from the phage particles by phenol extraction (21). The K11 RNAP gene was amplified from phage DNA by polymerase chain reaction (PCR) using Pfu DNA Polymerase (Stratagene, La Jolla, CA, USA) and the primers MR113 (CCGCTCGAGATGAACGCATTAAACATTGG) and MR114 (CGGAATTCTTACGCAAACGCGAAGTCAGA). These Benchmarks
منابع مشابه
Identification of bacteriophage K11 genomic promoters for K11 RNA polymerase.
Only one natural promoter that interacts with bacteriophage K11 RNA polymerase has so far been identified. To identify more, in the present study restriction fragments of the phage genome were individually assayed for transcription activity in vitro. The K11 genome was digested with two 4-bp-recognizing restriction enzymes, and the fragments cloned in pUC119 were assayed with purified K11 RNA p...
متن کاملBacteriophage T7 RNA polymerase-based expression in Pichia pastoris.
A novel Pichia pastoris expression vector (pEZT7) for the production of recombinant proteins employing prokaryotic bacteriophage T7 RNA polymerase (T7 RNAP) (EC 2.7.7.6) and the corresponding promoter pT7 was constructed. The gene for T7 RNAP was stably introduced into the P. pastoris chromosome 2 under control of the (endogenous) constitutive P. pastoris glyceraldehyde-3-phosphate dehydrogenas...
متن کاملBi-functional activities of chimeric lysozymes constructed by domain swapping between bacteriophage T7 and K11 lysozymes.
The lysozymes encoded by bacteriophage T7 and K11 are both bifunctional enzymes sharing an extensive sequence homology (75%). The constructions of chimeric lysozymes were carried out by swapping the N-terminal and C-terminal domains between phage T7 and K11 lysozymes. This technique generated two chimeras, T7K11-lysozyme (N-terminal T7 domain and C-terminal K11 domain) and K11T7-lysozyme (N-ter...
متن کاملA bacteriophage T 7 RNA polymerase / promoter system for controlled exclusive expression of specific genes ( T 7 DNA polymerase / T 7 gene 5 protein / proteolysis / 13 - lactamase / rifampicin ) STANLEY TABOR
The RNA polymerase gene of bacteriophage T7 has been cloned into the plasmid pBR322 under the inducible control of the X PL promoter. After induction, T7 RNA polymerase constitutes 20% of the soluble protein of Escherichia coli, a 200-fold increase over levels found in T7-infected cells. The overproduced enzyme has been purified to homogeneity. During extraction the enzyme is sensitive to a spe...
متن کاملDesign, simplified cloning, and in-silico analysis of multisite small interfering RNA-targeting cassettes
Multiple gene silencing is being required to target and tangle metabolic pathways in eukaryotes and researchers have to develop a subtle method for construction of RNA interference (RNAi) cassettes. Although, several vectors have been developed due to different screening and cloning strategies but still some potential limitations remain to be dissolved. Here, we worked out a simple cloning stra...
متن کاملذخیره در منابع من
با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید
برای دانلود متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید
ثبت ناماگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید
ورودعنوان ژورنال:
- BioTechniques
دوره 27 4 شماره
صفحات -
تاریخ انتشار 1999